DNA Testing Methods

Details of each method

What Methods Are Used To Test DNA?

The DNA sequence for different individuals within the same animal species is very similar. For example, around 99.5% of your DNA is the same in everyone with precisely the same nucleotide sequence. It is what makes us human. So for DNA testing to be useful it must focus on the regions of the DNA in the 0.5% that varies considerably to help us tell the difference between people and determine individual genetic characteristics. Here is a quick description of the main types of test that are routinely offered:

STR Analysis
STRs (Short Tandem Repeats) are the workhorses of human identification and relationship testing. As the name suggests they are relatively short sequences of DNA that are repeated multiple times next to each other in a line along the DNA strand (tandem just means one after the other in a line).  No one is exactly sure why STRs exist but a feature of DNA is that it has lots of lengths of repeating sequences through out the genomes of all animals. Here is an example of a length of DNA that contains an STR nucleotide sequence, it contains three of the four letters of the genetic code, C G A T:

…TCATTCATTCATTCATTCATTCATTCATTCATTCAT…

This is the sequence of an STR called “THO1” and it is found on human chromosome number 11. Notice that the nucleotide sequence TCAT is repeated multiple times, 9 times in this example.

The great advantage of STRs is that they vary hugely between individuals and they are easy to test. The variation doesn’t come from the nucleotide sequence so much but rather the number of repeats that a person has. For example one person might have 9 repeats and another 6. To distinguish one person from another the DNA analysis is focused on counting the number of repeats. Typically, an individual’s STR repeat number for a particular STR ranges between 4 and 40. To give increased power to STR tests we test many, up to 24, STRs in a single test simultaneously using commercially available kits.  If we need to, we can increase this number by testing with other panels of STRs in different kits.

Like most DNA, your STR repeat numbers are inherited from your parents. It is ideally suited for paternity testing and investigating other family relationships as well as identifying the source of a sample of DNA. It is also the main type of test used in forensic science and is used extensively by law enforcement agencies around the world.

Below is one persons STR test result. It shows a typical test that analyses 15 STRs simultaneously and also includes a sex test (the X Y result means this person is male). Each STR appears as a peak in a position that corresponds to its repeat number and the first box under the peak tells us what the repeat number is. Most results give a pair of peaks for every STR because one is inherited from mother and the other from the father. Where there is only a single peak this is because the persons mother and father have both passed on an STR with the same repeat number. In the test below there are 4 STR results in blue, 5 in green, 4 in black and 2 in red plus the sex test.

STR epg

Y-STR Analysis
As you might have guessed, Y-STRs are just STRs that are found on the male Y-chromosome. It is the presence of the Y-chromosome in a fertilized egg that determines the gender of the child. The pair of sex chromosomes of a male are XY and for a female XX. Y-chromosomes are hereditary and passed from father to son through the generations. They are ideal to investigate the male genetic line. For example, in many cultures the surnames of families are passed on through the male line, just like Y-STRs, and in the absence of any other information, it is often possible to look at a man’s Y-STR type compare it with a database of Y-STR results and make predictions about his, and his father’s, surname! Particularly useful in adoption cases where a male is unsure who his parents are and wishes to find them.

MtDNA Sequencing
MtDNA stands for mitochondrial DNA. Mitochondria are the biological machines in our cells that convert food into energy. In some respects they are like a cell in their own right – a cell within a cell if you like. One important feature of mitochondria is that each one contains several copies of their own small strand of DNA, quite separate from the chromosomal DNA in the nucleus.

Mitochondrial DNA

Typical human cell structure showing mitochondrial DNA. Chromosomal DNA is contained within the nucleus which is shown in blue.

No mtDNA passes to the egg from the sperm during fertilization and so everyone’s mtDNA, both male and female, is inherited from their mothers. Men get it from their mothers but don’t pass it on to their children. MtDNA contains regions where the nucleotide sequence varies considerably between unrelated people. Much like Y-STRs for males, mtDNA sequencing is ideal to investigate the female genetic line. MtDNA tests, sometimes called X-SV tests, are available to help establish if siblings share the same biological mother, or two people share the same maternal lineage. (X-SV is a bit misleading because mtDNA is entirely different from X chromosome DNA).

SNP Testing
SNPs, pronounced “snips”, are Single Nucleotide Polymorphisms. As the name suggests they are points along the DNA strand where we find single nucleotide sequence differences between individuals (nucleotides are the small DNA building blocks that are joined end to end to form long DNA strands – there are four different types and their sequence determines the genetic code). There are many millions of SNPs spread throughout the 3 billion nucleotides in the human genome. The beauty of SNPs is that we now have technology that can test them in very large arrays, up to a million at a time in affordable tests and the are many ways in which the technology can be used for private DNA testing. Here are the main ones…

  • Recently SNP techniques have started to be offered for non-invasive Prenatal Paternity Testing in which huge SNP arrays are used to look for the baby’s paternal genetic sequences from just a sample of mother’s blood. This approach allows a highly accurate paternity test to be carried out on the unborn child from as early as 9 weeks into pregnancy from maternal blood with no risk to the unborn child.
  • SNPs can be used to measure how closely related two people are which is especially helpful when relationships are more distance and STRs are of little value such as with cousins and second cousins (see More Distant Relationships and Finding New Family Members).
  • A fascinating use of SNPs is that many are linked to ancient human populations. This allows us to find out about our own ancient ancestral origins. For example, SNP tests can indicate to what extent you’re ancestry originates from Africans, Europeans, Native Americans, Asians, Australian Aborigines etc. They can even detect if you have ancient Neanderthal DNA in your blood!
  • In medicine researchers have found many SNP types that are closely linked to genetic traits and can predict these traits with a high degree of accuracy. This property of SNPs is very useful for a number of applications in relation to our personal health, for example, tests are available that can predict the likelihood that we will develop certain genetic diseases, the likelihood of contracting many conditions including diabetes, heart disease, dementia, cancers and how we might respond particular drug treatments. Our knowledge in this area is growing rapidly and individual DNA health assessments and personalized treatments are becoming more and more a part of every day medicine.

Chromosomal DNA Sequencing
Is the ultimate test. It simply sequences all of the nucleotides in your DNA to determine either your complete genetic code or the sequence of targeted informative regions of your DNA. This gives the analyst the potential to find out everything there is to know from your DNA, at least as far as current understanding will allow.

DNA Sequencing

At this moment in time the costs are too high for most people to have their entire DNA sequenced but the technology is developing rapidly. Within the next few years prices will come into the range of what many people and organizations can afford. A revolution in DNA testing is about to begin with huge implications for personalized medicine, relationship testing and human identification.